Author: "Pal, Aruna" / Journal: Small ruminant research / Text Availability: Citation in PubAg

Main content area

Author:: Pal, Aruna, et al. ; Chatterjee, P.N.; Show all 2 Author
Source:: Small ruminant research 2009 v.82 no.2-3 pp. 84-87
ISSN:: 0921-4488
Subject:: immunity; complementary DNA; open reading frames; goats; polymerase chain reaction; amino acid sequences; antimicrobial peptides; codons; genomics; immune system; molecular cloning; molecular weight; animal genetics
Abstract:: ... The present study was carried out in the Animal Genetics Division, Indian Veterinary Research Institute. The cDNA for CD14 gene of goat was amplified for the first time using PCR with ATGGTCTGCGTGCCCTACCTG as forward primer and GGAGCCCGAGGCTTCGCGTAA as reverse primer. The PCR product of 1122bp was eluted, purified, cloned and sequenced by automated sequencer (ABI prism) using dideoxy chain termina ...
DOI:: 10.1016/j.smallrumres.2008.11.016
: http://dx.doi.org/10.1016/j.smallrumres.2008.11.016