Author: "Pal, Aruna" / Text Availability: Citation in PubAg

Author:: Pal, Aruna, et al. ; Pal, Abantika; Mallick, Amirul Islam; Biswas, P.; Chatterjee, P.N.; Show all 5 Authors
Source:: Genomics 2020 v.112 no.1 pp. 472-483
ISSN:: 0888-7543
Subject:: B-lymphocytes; Toll-like receptor 2; Toll-like receptor 4; biosecurity; cell-mediated immunity; chickens; evolution; gene expression; genes; immune response; leucine; mammals; messenger RNA; rearing; transmembrane proteins; turkeys; vaccination; India; Japan
Abstract:: ... Haringhata Black is the only registered indigenous poultry genetic resource of West Bengal till date. Molecular characterization of HB revealed that Bu-1 to be highly glycoylated transmembrane protein unlike mammalian Bu-1, whereas TLR2 of HB chicken was observed to be rich in Leucine rich repeat. HB chicken was observed to be genetically close to chicken of Japan, while distant to chicken breed o ...
DOI:: 10.1016/j.ygeno.2019.03.010
: https://dx.doi.org/10.1016/j.ygeno.2019.03.010

Author:: Pal, Aruna, et al. ; Pradhan, Meenakshi; Samanta, A.K.; Banerjee, Samiddha; Samanta, R.; Show all 5 Authors
Source:: Theriogenology 2018 v.119 pp. 121-130
ISSN:: 0093-691X
Subject:: arginine; bioinformatics; computer software; cytochrome b; energy; frameshift mutation; genotype; litter size; lysine; males; mitochondria; mitochondrial genes; mortality; mutants; oocytes; oxidative phosphorylation; phylogeny; physiological response; piglets; polypeptides; post-translational modification; protein structure; protein transport; reproductive system; reproductive traits; single nucleotide polymorphism; sows; stop codon; zygote
Abstract:: ... Cytochrome B is an important polypeptide of the mitochondria helpful in energy metabolism through oxidative phosphorylation. Cytochrome B plays an immense role in the reproduction of animals and due to its mutation prone nature, it can affect the basic physiology of animals. Cytochrome B affects reproductive system in males and equally plays an important role in transferring and providing energy i ...
DOI:: 10.1016/j.theriogenology.2018.05.015
: https://dx.doi.org/10.1016/j.theriogenology.2018.05.015

Author:: Pal, Aruna, et al. ; Chakravarty, Atish Kumar; Chatterjee, Paresh Nath; Show all 3 Authors
Source:: Theriogenology 2014 v.81 no.3 pp. 474-480
ISSN:: 0093-691X
Subject:: zebu; semen; leucine; bulls; flehmen; somatotropin; valine; reproductive performance; sperm motility; genotype; acrosome; progeny testing; statistical analysis; exons; introns; libido
Abstract:: ... The decline in the male reproductive ability in terms of sexual behavior and seminal traits might lead to nonavailability of required number of bulls in a progeny testing program. The present study was conducted in 493 crossbred cattle (Bos taurus × Bos indicus) bulls to study polymorphisms of growth hormone (GH) gene and its association with seminal and sexual behavioral characteristics. A 428-ba ...
DOI:: 10.1016/j.theriogenology.2013.11.002
: https://dx.doi.org/10.1016/j.theriogenology.2013.11.002

Author:: Pal, Aruna, et al. ; Chatterjee, P.N.; Show all 2 Author
Source:: Small ruminant research 2009 v.82 no.2-3 pp. 84-87
ISSN:: 0921-4488
Subject:: immunity; complementary DNA; open reading frames; goats; polymerase chain reaction; amino acid sequences; antimicrobial peptides; codons; genomics; immune system; molecular cloning; molecular weight; animal genetics
Abstract:: ... The present study was carried out in the Animal Genetics Division, Indian Veterinary Research Institute. The cDNA for CD14 gene of goat was amplified for the first time using PCR with ATGGTCTGCGTGCCCTACCTG as forward primer and GGAGCCCGAGGCTTCGCGTAA as reverse primer. The PCR product of 1122bp was eluted, purified, cloned and sequenced by automated sequencer (ABI prism) using dideoxy chain termina ...
DOI:: 10.1016/j.smallrumres.2008.11.016
: http://dx.doi.org/10.1016/j.smallrumres.2008.11.016

Main content area