PubAg

Main content area

First Report of Powdery Mildew Caused by Golovinomyces spadiceus on Helianthus annuus

Author:
Moparthi, S., Bradshaw, M. J., Grove, G. G.
Source:
Plant disease 2018 v.102 no.6 pp. 1176
ISSN:
0191-2917
Subject:
DNA primers, Golovinomyces, Helianthus annuus, agar, agricultural industry, ambient temperature, appendages, appressoria, asci, conidia, conidiophores, fungi, gardens, germ tube, germination, hosts, internal transcribed spacers, leaves, mycelium, oils, pathogenicity, perennials, phylogeny, polymerase chain reaction, powdery mildew, ribosomal DNA, seeds, Japan, Washington (state)
Abstract:
Helianthus annuus is a perennial plant native to the United States. Commonly known as a sunflower, H. annuus is grown ornamentally as well as for its oil and seeds. It can grow up to 8 ft in height. In August 2017, H. annus ‘Lemon Queen’ leaves showing signs of powdery mildew were collected from the Pierce County master garden located at Washington State University Puyallup Research and Extension Center (47.2258°N, 122.4347°W). Signs of the powdery mildew included dense patches of white to greyish mycelia on the leaf surfaces. The fungus formed superficial branched hyphae with septa. The foot cells were straight and were followed by one to three short cells bearing conidia. The conidiophores contained short chains of up to five conidia. The hyphal appressoria were nipple shaped. The conidia were hyaline and ellipsoidal. The Eudoidium type of conidial germination with a short germ tube developed. The conidia (n = 55) ranged from 29 to 39 μm long (average, 36 μm) by 16 to 24 μm wide (average, 18.61 μm). Chasmothecia showed myceloid appendages, with five asci arranged as a bunch with a short stalk. The morphological features were consistent with those of Golovinomyces spadiceus from the description in Braun and Cook (2012). To confirm the identification, the complete internal transcribed spacer (ITS) region and the 5′ end of the large subunit rDNA containing D1, D2, and D3 were amplified using the primers ITS₁-F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns 1993) and TW₁₄ (GCTATCCTGAGGGAAACTTC) (Hamby et al. 1988). The resulting amplicon (size 1,460 bp) was sequenced using the primers ITS₁-F and TW₁₄. BLAST search indicated that the ITS+28S sequence (MF919431) was identical to G. spadiceus from Japan (AB769421.1). Helianthus species, including H. annuus, are common hosts of Golovinomyces ambrosiae (Braun and Cook 2012). Two phylogenetically closely allied Golovinomyces species occur on hosts belonging to the composite tribe Heliantheae, namely, G. ambrosiae and G. spadiceus (Takamatsu et al. 2013). A clear phylogenetic separation and sufficient resolution based only on ITS data are not possible, but the two species are morphologically clearly differentiated and easily distinguishable. G. ambrosiae differs from G. spadiceus in that it has much broader conidia (25 to 45 × 15 to 27 µm), with a length/width ratio usually ranging from 1.4 to 1.6 and a high percentage of long filiform germ tubes without swollen tips (longitubus pattern within the Eudoidium type) (Braun and Cook 2012). Pathogenicity was confirmed by inoculating 20 leaf discs (that were placed on water agar Petri plates). Conidia were gently dusted onto the leaf disks from heavily infected G. spadiceus leaves. The same number of leaf discs were not inoculated and were used as a control. The inoculated and noninoculated plates were kept on a lab table at room temperature. One week after postinoculation, the inoculated leaf discs showed signs of powdery mildew, whereas the control failed to develop powdery mildew signs. The morphological features of the powdery mildew fungus on the inoculated plants were similar to the fungal isolate that was collected from the master garden. This is the first report of G. spadiceus on H. annuus worldwide and the first on a species of the genus Helianthus in general. These results reveal that Helianthus species may be infected by G. spadiceus as well as the common infections caused by G. ambrosiae. This is important for the agricultural industry, for which H. annuus is a major crop.
Agid:
6139950