PubAg

Main content area

First Report of Cucumber Target Leaf Spot, Corynespora cassiicola, on Cucumber in Heilongjiang, Northeastern China

Author:
Liu, D. W., Liu, D., Liu, Q. Y., Zhang, D., Tao, L., Zhang, Y. J.
Source:
Plant disease 2019 v.103 no.4 pp. 765
ISSN:
0191-2917
Subject:
Corynespora cassiicola, Cucumis sativus, cities, cold, conidia, cucumbers, culture media, financial economics, fungi, growth chambers, insects, internal transcribed spacers, leaf spot, leaves, mercuric chloride, mycelium, oligodeoxyribonucleotides, pathogenicity, pathogens, polymerase chain reaction, ribosomal DNA, sequence analysis, spraying, surveys, tissues, China
Abstract:
Cucumber (Cucumis sativus) is a widely cultivated plant in the gourd family worldwide. However, cucumber is susceptible to many pathogens and insects, which results in a great deal of economic losses. Cucumber target leaf spot is an important disease caused by Corynespora cassiicola, which has been documented in Liaoning, Shandong, Shanghai, Henan, Hebei, Gansu, and Ningxia Provinces in mainland China (Li et al. 2009; Liu et al. 2012; Wang et al. 1997; Zeng et al. 2011). In June 2013, a survey for cucumber target leaf spot was undertaken in the cities of Harbin, Qiqihar, Mudanjiang, and Jiamusi of Heilongjiang Province. The results showed that the disease was only observed in Harbin. However, the pathogen spread quickly and reoccurred in other cities of Heilongjiang Province including Daqing, Jiamusi, Mudanjiang, Qiqihar, and Suihua. An accurate diagnosis is necessary for effective and economic management of the disease; therefore, an attempt was made to reaffirm the cause of the disease in these new locations. To isolate the pathogen, leaf tissues (5 × 5 mm) were cut from the lesion margin, surface disinfected in 75% alcohol for 15 s, soaked in 0.1% mercuric chloride for 20 s, washed with sterile distilled water three times, and cultured on potato dextrose agar at 28°C for 7 days. Subsequent colonies were gray or dark brown with aerial mycelium. Conidia formed as single spores or in chains and were straight or curved, cylindrical, or obclavate. Conidia ranged in size from 19.68 to 149.93 × 3.69 by 15.51 µm and had 1 to 12 pseudoseptations with a conspicuous thickened hilum. Based on morphological and cultural characters, the fungus was preliminarily identified as Corynespora cassiicola (Zheng et al. 2016). To confirm the identity of the fungus, genomic DNA was extracted with a DNA isolation kit (UNIQ-10 Column Fungal Genomic DNA Isolation Kit, Shanghai), amplification of the internal transcribed spacer (ITS) region was performed with primers ITS1 (TCCGTAGGTGAACCTGCGG) and ITS2 (TCCTCCGCTTATTGATATGC), and the purified polymerase chain reaction product was sequenced. A GenBank BLAST search revealed that the ITS sequences showed 100% similarity with that of C. cassiicola isolated from cucumber (JQ595296.1; JQ595297.1). Additionally, the specific primer pair CIR5 (GGACCCACCACAAACCCA) and CIF5 (ACAGACGCCCAAACACCAA) was used to identify the fungus; BLAST analysis showed the sequence was 99% identical with C. cassiicola (FJ594961.1). Morphologic characters and sequence analysis of the ITS rDNA confirmed that the pathogen was C. cassiicola. A pathogenicity test was conducted on intact plants according to Koch’s postulates. Fresh leaves were washed with sterile water and inoculated by spraying with a conidial suspension (1 × 10⁵/ml). Sterile water served as a control. All samples were incubated in a growth chamber at 27°C. Symptoms typical of target leaf spot developed on the leaves after 7 days, but control samples remained healthy. The morphology of reisolated pathogen from symptomatic tissues was consistent with that on diseased lesions. To our knowledge, this is the first report of cucumber target leaf spot in Heilongjiang province, northeastern China. The survival and quick spread of the pathogen in Heilongjiang province, an extremely cold area of China, is a subject for further study.
Agid:
6368780